Die Herausforderung:

Erstellen Sie eine Funktion, die das längste Palindrom in einer Zeichenfolge findet.

^{Hinweis: Dies ist eine Code-Trolling- Frage. Bitte nehmen Sie die Frage und / oder die Antworten nicht ernst. Mehr Infos hier .}

Gehen

Die folgende Lösung in Go nutzt die verborgenen Kräfte von Parallelität, Closures und Rekursivität, um das längste Palindrom in einer bestimmten Zeichenfolge zu finden:

func lp(s string) string {
    for i, l := 0, len(s); i < l; i++ {
        if s[i] != s[l-i-1] {
            a, b := make(chan string), make(chan string)
            go func() {
                a <- lp(s[:l-1])
            }()
            go func() {
                b <- lp(s[1:])
            }()
            c, d := <-a, <-b
            if len(c) > len(d) {
                return c
            }
            return d
        }

    }
    return s
}

Darüber hinaus stützt es sich ausschließlich auf Sprachprimitive und integrierte Typen - keine Standardbibliothek - so erkennen Sie echte Qualitätssoftware.

Möglicherweise möchten Sie Ihre Thread-, Speicher- und Stack-Größenbeschränkungen für größere Eingabezeichenfolgen ein wenig erhöhen. Dies liegt daran, dass diese Lösung so schnell ist, dass Ihr Betriebssystem darauf eifersüchtig wird.

Bearbeiten - Vergünstigungen:

• Auf Multibyte-Zeichenketten völlig unbrauchbar.
• Lässt keine Interpunktions- oder Leerzeichen aus.
• Lässt die Gleichheit zwischen Groß- und Kleinschreibung aus.
• Läuft in einer schwer kalkulierbaren Zeit - allerdings sehr langsam.
• bringt je nach Eingabe viele, viele Goroutinen hervor.
• wird nach ein paar Sekunden auf meinem Computer mit über 16000 2049186 Goroutinen, die für die Eingabe erzeugt wurden, wegen Speichermangel getötet"345345ABCDEabcde edcbaDEABC12312123"

Python

def longest_palindrome(s):
    return 'racecar'

Anwendungsbeispiel:

>>> print longest_palindrome('I like racecars!')
racecar

Hinweis: Dies funktioniert möglicherweise nur für bestimmte Zeichenfolgen.

Es ist offensichtlich schwierig, nach Palindromen zu suchen.

Die Lösung ist also ziemlich einfach: Erstellen Sie einen Satz von jedem möglichen Palindrome, der so groß ist wie die Zeichenfolge, die Sie testen, und prüfen Sie, ob Ihre Zeichenfolge diese enthält.

C #

string largest = String.Empty;

    for(int i=0; i < myString.lenght; i++)
    {

//Don't use the newfangled stringbuilder. Strings are awesome
char[] testString = new char[i];

    for (int charPosition=0; charPosition < i/2; charPosition++)
    {
    for (char c = 'A'; c <= 'Z'; c++)
    {
       if ((charPosition/i) == i/2)
{
//middle one
testString[i] = c;
} 
else 
{
//do one for that position, and the lenght-position
testString[i] = c;
testString[testString.length - i] = c;
}

if (myString.Contains(testString.ToString())
{
//yaay
largest = testString.ToString();
}


{

}
    } 

}


}

(Möglicherweise muss ich meinen Code auf Korrektheit prüfen, aber ansonsten ist es eine wunderbar schrecklich ineffiziente Methode, nach Palindromen zu suchen.)

Perl

Hat alles nachgefragt. Es ist eigentlich besser, weil es jede mögliche Folge berücksichtigt . Was ist der Haken? Es arbeitet in exponentieller Zeit, so dass jedes zusätzliche Zeichen in der Zeichenfolge die Laufzeit verdoppelt. Gib es mehr als 20 Zeichen, und es wird den ganzen Tag dauern.

$inputstring = <>;
@arrayofcharacters = split("",$inputstring);
for(0..2**length($inputstring)-1){
 $currentsubsequence = "";
 @choice=split("",sprintf("%b",$_));
 for(0..$#arrayofcharacters){
  $currentsubsequence .= "$arrayofcharacters[$_]" x $choice[$_];
  if($currentsubsequence eq reverse($currentsubsequence)){
   $palindromes{length($currentsubsequence)} = $currentsubsequence;
   $palindromes[~~@palindromes] = length($currentsubsequence);
  }
 }
}
print($palindromes{@{[sort(@palindromes)]}[$#palindromes]})

Input: iybutrvubiuynug. Ausgabe:ibutubi .

Input: abcdefghijklmnopqrstuvwxyzzyxwvutsrqponmlkjihgfedcba. Ausgabe: wird nicht passieren

Ihr Problem wird einfach durch reguläre Ausdrücke gelöst, genau wie in der Abbildung unten (aber ich habe mich stattdessen für Java entschieden). Dies liegt daran, dass Regex immer das beste Tool ist, das für alle Aufgaben verwendet werden kann, bei denen Text extrahiert oder analysiert wird.

package palindrome;

import java.util.regex.Pattern;
import javax.swing.JOptionPane;

public class RegexPalindrome {

    private static String next(String now) {
        if (now.isEmpty()) return "a";
        String prefix =  now.length() == 1 ? "" : now.substring(0, now.length() - 1);
        if (now.endsWith("z")) return next(prefix) + "a";
        return prefix + String.valueOf((char) (now.charAt(now.length() - 1) + 1));
    }

    public static void main(String[] args) {
        String text = JOptionPane.showInputDialog(null, "Type some text:");

        String bestPalindromeFound = "";

        for (String searchText = "a"; searchText.length() <= (text.length() + 1) / 2; searchText = next(searchText)) {
            String reverse = new StringBuilder(searchText).reverse().toString();
            if (searchText.length() * 2 - 1 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse.substring(1) + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse.substring(1);
            }
            if (searchText.length() * 2 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse;
            }
        }
        JOptionPane.showMessageDialog(null, "The longest palindrome is \"" + bestPalindromeFound + "\".");
    }
}

Dieser Code ist böse, weil:

• Es läuft in exponentieller Zeit bis zur Größe des angegebenen Textes. Es wird ausgeführt, indem alle Zeichenfolgen in der Form az aufgelistet, zwei reguläre Ausdrücke für jede generierte Zeichenfolge erstellt und die Eingabe für jede reguläre Ausdrücke getestet werden.
• Außerdem schlägt es fehl, wenn das Palindrom Großbuchstaben, Zahlen, Nicht-ASCII-Text, Interpunktion usw. enthält.
• Und natürlich ist Regex eindeutig nicht das richtige Werkzeug dafür.

Python

Dadurch wird die Zeichenfolge auf das längste verfügbare Palindrom umstrukturiert.

Beispielsweise:

Eingabe: Hallo

Ausgang: lol

def get_palindrome(string):
    if len(string) == 0:
        return "I didn't catch that"
    list_of_characters = []
    occurances = []
    for character in string:
        if not character in list_of_characters:
            list_of_characters.append(character)
            occurances.append(1)
        else :
            occurances[list_of_characters.index(character)] +=1
    #check if a palindrome is possible
    if sum(occurances) == len(occurances): #no double letters, so only a one character palindrome
        return list_of_characters[0]
    first_half = ''
    second_half = ''
    middle_character = ''
    for index, character in enumerate(list_of_characters):
        number_of_occurances = occurances[index]/2
        first_half += character * number_of_occurances
        second_half = (character * number_of_occurances)+ second_half
        if (occurances[index]%2 != 0):#if there are an odd number, there will be one spare,
            #so put it in the middle
            middle_character = character
    return first_half + middle_character + second_half


print(get_palindrome(raw_input("String containing palindrome:")))

Bioinformatik Interpretation

Sehr cooler Frage-Typ!

Palindrome in normaler Sprache sind nicht eindeutig spezifiziert, zum Beispiel ob Leerzeichen erlaubt sind oder nicht. Es ist also nicht klar, ob diese als Palindrome zugelassen werden sollen oder nicht:

• Sehen Gänse Gott?
• Ein Mann, ein Plan, ein Kanal - Panama!

Wie auch immer, ich denke, Sie beziehen sich auf die besser spezifizierte wissenschaftliche Bedeutung von Palindrom: Damit eine Nukleotidsequenz als Palindrom betrachtet werden kann, muss ihr komplementärer Strang dasselbe in entgegengesetzter Richtung lesen. Sowohl die Stränge, dh der Strang von 5 'nach 3' als auch sein komplementärer Strang von 3 'nach 5' müssen komplementär sein (siehe hier ).

Es gibt einige Forschungsarbeiten zur Erkennung von Palindromsequenzen, und ich denke, Sie sollten dies zumindest wirklich lesen . Um Ihr Problem zu lösen, können Sie den Ansatz so ziemlich einfach kopieren! Der Professor sendet sogar den Quellcode, wenn Sie ihn fragen.

Nun zum eigentlichen Problem. Angenommen, Sie haben eine Nukleotidsequenz als Zeichenfolge angegeben. Der beste Weg, Palindrome in einer solchen Sequenz zu finden, ist die Verwendung von Standardalgorithmen. Ich denke, Ihre beste Wette ist wahrscheinlich die Verwendung dieses Online-Tools: http://www.alagu-molbio.net/palin.html

Da Sie eine Funktion bereitstellen müssen, die die Aufgabe übernimmt, müssen Sie sich überlegen, wie Sie Ihren String in diese App integrieren können. Nun, da fängt der Spaß an. Ich denke, Sie könnten Selen dafür verwenden. Da ich Ihre Hausaufgaben nicht machen möchte, gebe ich Ihnen nur die Grundidee. In Java beginnt Ihre Welt so:

package testing;

import java.util.regex.Matcher;
import java.util.regex.Pattern;

import org.openqa.selenium.By;
import org.openqa.selenium.WebDriver;
import org.openqa.selenium.WebElement;
import org.openqa.selenium.phantomjs.PhantomJSDriver;

public class PalindromeService {


    public static void main(String[] args) {
        WebDriver d1 = new PhantomJSDriver();

        d1.get("http://www.alagu-molbio.net/palin.html");

        String sequence = "AAGTCTCGCGAGATCTCGCGAGATCTCGCGAGATCTCGCGAGAAA";

        WebElement txtArea = d1.findElement(By.tagName("textarea"));

        txtArea.sendKeys(sequence);

        WebElement send = d1.findElement(By.cssSelector("input[type=submit]"));
        send.click();

        String result = d1.findElement(By.tagName("body")).getText();

        Pattern p = Pattern.compile(".*capitalized\\.[^agctACGT]*([agctACGT]+).*");
        Matcher m = p.matcher(result);
        if (m.find()){
            result = m.group(1);
        }

        //now you have all palindromes in upper case! 
        //I think you can take it from here, right?

        System.out.println(result);

        d1.quit();
    }
}

Wenn Sie an Sprachpalindromen interessiert sind, können Sie dieselbe Technik mit anderen Webdiensten wie http://www.jimsabo.com/palindrome.html oder http://calculator.tutorvista.com/math/492/palindrome-checker verwenden .html

Code-Trolling-Technik

• Lassen Sie die wirklich hilfreichen Quellen wie http://rosettacode.org/wiki/Palindrome_detection weg

• Interessant, aber wenig hilfreich in Sachen Bioinformatik

• absichtlich missverstehen dies als bioinformatische Aufgabe

• Schummeln - um das Problem zu lösen, wird ein Webdienst verwendet

Python

def get_substrings(a_string):
    """Get all possible substrings, including single character substrings"""
    for start_index in range(len(a_string)):
        for end_index in range(start_index + 1, len(a_string) + 1):
            yield a_string[start_index:end_index]

def get_longest_palindrome(a_string):
    """Find the longest palindrome in a string and return its index or -1"""

    # Initialise variables
    longest_palindrome = get_longest_palindrome.__doc__[5:27]
    palindromes_list = []

    # Search string for all palindromes
    for substring in get_substrings(a_string):
        if reversed(substring) == substring:
            palindromes_list.append(substring)

    # There should always be palindromes in non-empty strings (single characters),
    # but it's good practice to check anyway
    if len(palindromes_list) > 0:
        longest_palindrome = max(palindromes_list, key=len)

    return a_string.find(longest_palindrome)

Die Zeichenfolge "das längste Palindrom" wird aus der Dokumentzeichenfolge in extrahiert longest_palindrome.

Die reversed()Funktion gibt einen Iterator zurück, ist also reversed(substring) == substringniemals wahr und longest_palindromewird niemals überschrieben.

Daher findet die Funktion buchstäblich "das längste Palindrom" in einer Zeichenfolge.

Javascript

Oh, das ist einfach;). Hier gehts:

function () {
    var palidrome = "Star? Not I! Movie – it too has a star in or a cameo who wore mask – cast are livewires.

Soda-pop straws are sold, as part-encased a hot tin, I saw it in mad dog I met. Is dog rosy? Tie-dye booths in rocks.

All ewes lessen ill. I see sheep in Syria? He, not I, deep in Syria, has done. No one radio drew old one.

Many moths – I fondle his; no lemons are sold. Loot delis, yob, moths in a deli bundle his tin. Pins to net a ball I won – pins burst input. I loot to get a looter a spot paler. Arm a damsel – doom a dam. Not a base camera was in a frost, first on knees on top spot. Now a camera was a widened dam.

Ask: Cold, do we dye? No, hot – push tap, set on to hosepipe. Nuts in a pod liven.

A chasm regrets a motto of a fine veto of wars. Too bad – I all won. A sadist sent cadets – a war reign a hero derides. A bad loser, a seer, tossed a cradle – he begat to cosset – a minaret for Carole, Beryl, Nora. We’re not as poor to self.

I risk cold as main is tidal. As not one to delay burden, I don’t set it on “hot”. A foot made free pie race losses runnier. As draw won pull, eye won nose. Vile hero saw order it was in – even a moron saw it – no, witnessed it: Llama drops – ark riots. Evil P.M. in a sorer opus enacts all laws but worst arose. Grab a nosey llama – nil lesser good, same nicer omen.

In pins? No, it is open. If a top spins, dip in soot.

Madam, as I desire, dictates: Pull aside, damsels, I set a rag not for a state bastion. A test I won e.g. a contest I won.

Kidnap, in part, an idle hero. Megastars, red, rosy, tied no tie. Blast! A hero! We do risk a yeti’s opposition!

He too has a wee bagel still up to here held.

Demigods pack no mask, cap nor a bonnet, for at last a case is open – I left a tip – it wets. A dog wets too. Radios to help pay my tip, pull a tip.

Ale, zoo beer, frets yon animal. Can it? New sex arose but, we sots, not to panic – it’s ale – did I barrel? Did I lose diadem, rare carrot in a jar of mine? Droop as tops sag – unseen knots.

A cat ate straw as buck risk cud; evil foe, nil a red nag ate? Bah! Plan it – silage. Model foot in arboreta.

I, dark Satanist, set fire – voodoo – to slat. I design a metal as parrot, I deem it now. One vast sum is no ten in set – amen! Indeed, nine drag a yam, nine drag a tie. Dame nabs flower; can we help man? Woman is worse nob.

Mud level rose, so refill a rut. A nag of iron I made to trot I defied – I risk leg and its ulnae. Can a pen I felt to bid dollar or recite open a crate, open a cradle, his garret?

Sample hot Edam in a pan. I’m a rotten digger – often garden I plan, I agreed; All agreed? Aye, bore ensign; I’d a veto – I did lose us site. Wool to hem us? No, cotton. Site pen in acacias or petals a last angel bee frets in.

I met a gorilla (simian); a mate got top snug Noel fire-lit role. Manet, Pagnol, both girdle his reed bogs.

Flan I reviled, a vet nods to order it, Bob, and assign it. Totem users go help mates pull as eye meets eye. Son – mine – pots a free pie, yes? No. Left a tip? Order a dish to get. A ring is worn – it is gold. Log no Latin in a monsignor, wet or wise. Many a menu to note carrot.

Cat in a boot loots; As I live, do not tell! A bare pussy, as flat on fire, I know loots guns, fires a baton, nets a hero my ale drop made too lax.

If it is to rain, a man is a sign; I wore macs, no melons rot. I use moths if rats relive, sir, or retire.

Vendor pays: I admire vendee, his pots net roe. Nine dames order an opal fan; I’ll ask cold log fire vendor to log igloo frost. Under Flat Six exist no devils.

Marxist nods to Lenin. To Lenin I say: “Mama is a deb, besides a bad dosser.”

Gen it up to get “ova” for “egg”. I recall a tarot code: yell at a dessert side-dish sale. Yes/nos a task cartel put correlate: E.S.P. rocks a man. I am a man, am no cad, I’m aware where it’s at!

Fire! Its an ogre-god to help, man, as I go. Do not swap; draw, pull a troll!

It’s not a cat I milk – calf, for a fee, sews a button – knit or tie damsel over us. Mined gold lode I fill until red nudes I met in a moor-top bar can. I sit, I fill a diary – trap nine men in ten-part net – oh, sir, I ask, cod nose? No, damp eel.

So, to get a name! I say, Al! I am Al! Last, I felt, to breed, deer begat.

To can I tie tissue – damp – or deliver Omani artist – a man of Islam.

In a den mad dogs lived on minis a signor who lived afore targets in at. As eremites pull, I, we, surf, fantasise, mend a bad eye. No hero met satyr; Tony, as I stressed, won’t, so cosset satyr.

A vet on isles made us sign it, a name. Foe man one sub.

Aside no dell I fret a wallaby; metal ferrets yodel, like so. On a wall I ate rye. Bored? No, was I rapt! One more calf? O.K., calf, one more, bossy! No! Lock cabin, rob yam, sip martini. Megastar was in a risk.

Cat? No, I’m a dog; I’m a sad loyal pet. A design I wore – kilts (a clan); if net drawn, I put it up. Royal spots snag – royal prevents rift.

Composer, good diet, are both super, God – label it a love of art, lustre. Video bored, no wise tale e.g. a mini tale – no sagas seen. Knack: cede no foes a canal.

Pay – as I sign I lie; clear sin it is; e.g. “Amadeus” sign I – lira for ecu, decimal – sin as liar.

Trad artistes pull a doom, a drawer won’t.

Is it sold loot? No, I suffered loss. A man is god; Amen! I came nice Tahiti (sic).

It’s ale for a ban if for a fast – is role to help mash turnip? Use zoo? No – grasp order – use no zoos. Warts on time did sag.

No grade “X” “A” Level? Oh, “A”! I’d a “B” or a “C”. So – pot? No, we lop. Date? Take no date! Bah! Play L.P.

Miss (a lass, all right?) flew to space in NASA era. Rose no (zero) cadets ate raw. As a wise tart I fined rags red Lenin, we help pay bet – a risk – cash to Brian. I put a clam in a pool – a pool wets.

Mahdi puts a stop to harem – miss it in one vote, lost in one, veto of none. Post-op, no tonsil; I ate; no tastier, eh? We sleep at noon time so I dare not at one; no time stops as I time tides. A bed: under it, roll; in a mania, panic!

In a pond I did as Eros as Lee felt tenrec. “Ink” – list it under “I”. Termites put pen in a way. Democrats wonder, I too. To slay moths a dog did.

I saw elf; elf, far now, is a devilish taboo, rag-naked. I hid a bootleg disc. I, saboteur, toss it in. Oops! No legs! Laminated, a cask, conker in it, negates all if it is simple.

Hot pages are in a mag, nor will I peer, familiar tat, so lewd, native rot. Toner, ewe wore no trace; vagabond ewes do. Oh, Ada! Have pity! A pitiable eel – “Oh wet am I!” – to save, note: bite gill as I do.

Call a matador minor, eh? As I live, don’t! Is torero no rigid animal debaser if tipsy? Ale drew esteem in a matador. A bolero, monks I rate play or go dig rocks; a can I step on.

Go! Gas – it evades a bedsit – set a roost on fire. Boss sent a faded eclair to green imp or dog, I’d don a belt to boot it; if Ada hid a boot, panic.

I mock comic in a mask, comedian is a wit if for eventide. Vole no emu loved is not a ferret, so pet or witness a weasel if not. I hired less, am not so bossy, as yet amateur.

To stir evil, Edna can impugn a hotel: bad loos, hot on Elba: I may melt. Tart solicits it rawer, gets it rare. Push crate open; I ram buses, use no trams.

Did I say, not to idiot nor a bare ferret, to trap rat, strap loops rat? Stewpot was on. Hot? I was red! Lessen it! Fine man on pot? No, pen inside by a bad law. So I made rips – nine delays.

Some Roman items in a.m. ordered “Is room for a ban?” “It is,” I voted: I sat pews in aisle. Beryl, no tiro to my burden, made off for a contest, I won kiss. I may raid fine dales. I raid lochs if I to help am.

Forecast for Clare v. Essex: If no rain, a man is ref. Fusspots net foxes.

Senor is a gnome, latinos’ bad eyesore. Help misses run to border, Casanova, now, or drab hotel.

Ma has a heron; I sleep, pet’s on nose, sir! Rev. I rag loved art live – fine poser. Ultra-plan: I feign, I lie: cedar to disperse – last one? No, last six. Enamel bonnet for a dark car to toss a snail at. In it all, Eve lost; Seth’s a hero slain on a trap – Rise, Sir Ogre Tamer.

Upon Siamese box I draw design. I, knight able to help, missed an alp seen in Tangier of fine metal pots. Tin I mined rages – order nine, melt ten. Tone radios; tones are not to concur. Ten-tone radar I bomb – best fire-lit so hostel side meets eerie mini red domicile. A gulf to get is not a rare tale; no time to nod.

Row on, evil yobs, tug, pull. If dogs drowse, fill a rut. An era’s drawers draw. Put in mid-field in a band I dig a tub deep. Staff on a remit did refill a minaret.

Sam’s a name held in a flat, or, sir, bedsit. I wonder, is it illicit ore? No ties? A bit under? Retarded? Is ‘owt amiss? I’m on pot; not so Cecil, a posh guy a hero met. A red date was not to last so Cecil sat.

Tip? An iota to pay, a dot; sad, I drop item. I’d ask, call, Odin, a Norseman’s god: “Pay payee we owe radio dosh o.n.o.” I to me? No, I to media.

Peril in golf – is ball a “fore”? K.O.!

Vexed I am re my raw desires. Alto has eye on nose but tone-muser pianist is level-eyed. I lost a tie. Blast! In uni no grades are musts. Avast! Never port! Sea may be rut.

Part on rose? – It’s a petal. Define metal:

Tin is . (I gulp!) can!

I am a fine posse man, I pull a ton. Ron, a man I put on, I made suffer of evil emu’s sadism. Leo’s never a baron – a bad loss but evil – topple him, Leo’s lad. Assign a pen, can I? A pal is note decoding.

Is damp mule tail-less? No, ill; I breed for its tone. Radio speed, to grower, grew. Open a lot? No, stamp it; if for a free peso – not ecu -deign it. Times ago stone rates, e.g. at Scilly, display a wont.

No wish to get a design I, Sir Des, I’ve let? No bus sees Xmas fir. O.K. – cab – tart it up; tie lots – diamond, log or tinsel; first end errata edit. So “le vin (A.C.)”, Martini, Pils lager, one tonic.

I pegged a ball up to here when I got a top star role, Beryl. Gun is too big – won’t I menace? Yes? No?

Ill? A cold? Abet icecap’s nip. U.S.A. meets E.E.C. inside tacit sale – see! Beg a cotton tie, ma! No trial, so dodo traps exist. Arabs under-admire card label good hood stole.

In rage erupted Etna. Will a rotunda, bare villa, to tyro. Lack car? Non-U! Get a mini! My, my, Ella, more drums per gong; get a frog – nil less. Rod, never ever sneer. Got to?

I disperse last pair of devils (ah!) here today or else order cash to breed emus. Said I: “Are both superlative?” C.I.D. assign it lemon peel still. I wore halo of one bottle from a ref (football) – a tip; so hit last ego slap a mate got.

Late p.m. I saw gnu here (non-a.m.) or an idea got a dog to nod – I made felt to boot.

Fill in a lad? Nay, not all, Edna – lash to buoy. Did you biff one Venus? Not I! “Broth, girl!” ladies ordered – “No, with gin!” – a fine plate, maybe suet; no carton I made rots in it.

Med: a hill, Etna, clears in it. Ali, Emir, to slap in/slam in. All in all I made bad losers sign it – alibi. Set a lap for a level bat.

A bed, sir, eh? To put cat now? Drat! Such an idyll of a dog’s lair! That`s it, open it – a cage! Big nit sent rat! Some day (A.D.) send ewe. No, draw a pot now, do! Of wary rat in a six ton tub.

Edna, ask satyr: “Tel. a.m.?” No, tel. p.m.; Israeli tuner is damp. Use item: “Anna Regina”. No! Dye main room (“salle”) red!

Nice caps for a sea cadet in U.S.A. – Now I, space cadet, am it, sea vessel rep. Pin it on Maria, help Maria fondle her fine hotpot. No! Meet; set up to net, avoid a lesion. Set acid arena: Bruno one, Reg nil. Like it to sign in? Even I am nine-toed! I vote votes.

Oh, can a nose-rut annoy? No, best is Dorset. I know, as liar, to snoop, malign. “I’ll order it to get a bedroom door,” began a miser I fed.

Am I to peer, fan? Is a door by metal? Ere sun-up, drowse, nod, lose magnet. Food? Buns? I’ll ask. Corn? I’ll ask. Corn – I snack. Cats snack (cold rat). Sum for a bag: nil. First, is remit “traps in net”? Yes, on a par. Coots yell over a dam I made. Bared nudist went a foot, I made roots. I tip a canon: “Row, sir, at same tide; man one: row tug.”

Sewer of denim axes a wide tail – a terror recipe to hero made manic. I, to resign? I ? Never!

“OFT I FELT ITS SENSUOUSNESS” – title fit for evening is erotic; I named a more hot epic – error retaliated – I was examined for ewe’s gut, wore no named item.

A star is worn on a cap, it is too red. Am I too fat? Newts I’d under a bed. Am I mad? Are volleys too crap? A nosey tennis part-timer sits rifling a bar of mustard.

Lock cans, stack cans in rocks, all in rocks, all I snub. Do often games, old ones, word-pun use; relate, my brood, as in a free pot I made fires, I manage brood. Moor debate got tired rolling, I lampoon, so trail saw on kites.

Rod sits, ebony on nature, so Nana chose to veto video. Ten in main evening is O.T.T. i.e. killing; Ere noon, urban eradicates noise, lad, I ovate not. Put esteem on top (to hen, if reheld).

No fair ample hair – am not I nipper-less? Eva estimated ace caps I won as united. A Caesar of space, Cinderella’s moor, Niamey Don (a Niger-an name), ties up mad sire, nut! I, Lear, simpleton male, try tasks “A” and “E”

but not “XI”. Sanitary raw food won top award one Wednesday – a demo.

Start nesting, I beg a cat. I? Nepotist? Ah, trials, God! A folly, Dinah, custard won’t act up; other is debatable. Velar: of palate; sibilating is “s”.

Resold: a bed, a mill, an ill animal – snip, also trim. Eilat in Israel can tell I had ‘em. Tin I stored (am I not raconteuse?) by a metal pen. If a night, I wondered, rose, I’d all right orbit on sun, even off.

I buoy, did you? Both Sal and Ella, Tony and Alan (“Ill if too bottle-fed, am I?”) do not. God! A toga! Ed in a Roman one, rehung! Was I, M.P. et al., to get a map? Also get salt? I, hospital lab to offer, am, or felt to be, no fool – a hero.

Will it sleep? No, melting is sad ice. Vital re-push to be raid, I assume. Deer, both sacred roes, Leroy (a doter, eh?) has lived for. I, apt sales rep’s idiot to greens, revere vendors selling or fat egg-nog reps.

Murder O’Malley, my mini mate – gun on rack. Calory total: liver, a bad nut or all I wanted (“et puree garnie”): lots. “Do, oh do, ogle bald racer,” I’m dared – N.U.S. bar at six.

Esparto, dodo’s lair to name it, not to cage bees, elasticated, is nice. Esteem, as up in space, cite bad local lions, eye can emit now. G.I. boots in ugly rebel or rat’s potato gin (eh?) were hot. Pull a bad egg – epic, I note, no regal slip in it. Ram can . (I’ve lost idea!)

Tarred nets, rifles, nitro, gold – no maid stole it. Put it, rat, back or if Sam (“X”) sees sub on televised rising, I sedate Goths. I won’t – no way.

Alps, idyllic stage set, are not so gas-emitting, I educe. To nose, peer, far off, I tip mats onto lane. Power grew or got deep so I dare not stir. Of deer, billions sell. I ate lump – mad sign, I do cede – tonsil a pain, acne pang is sad also. Elm I help pot, live – tub’s sold; a ban or a bar, even so, elms, I’d assume, live for. Effused am I not, up in a manor, not all up in a mess.

Open if a main A.C. plug is in it.

Late men I fed late – pasties or not. “Rapture” by a maestro prevents a vast sum erased.

Argon in units, albeit at solid eye level, sits in a . (I presume not) . tube, son. No eyes: a hot laser – is Ed wary?

Mermaid, ex- evoker of all A.B.s, I flog. Nil I repaid. Emotion! Emotion, oh so do I dare, woe!

Wee yap-yap dog’s name’s Ron. An idol lacks a dime tip, or did, as today a potato in a pitta slice costs a lot – tons. A wet adder ate more hay. Ugh! So, pal, ice cost on top? No, miss, I’m a two-sided rat, erred nut, I base it on erotic ill; It is I, red now; it is debris, rot.

Alf, an idle he-man as “master animal lifer” did time, ran off at speed, but a G.I. did nab an idle if dim nit. Upwards rewards are natural life’s words, God. Fill up guts, boy, live now or do not emit one later. A rat on site got flu.

Gaelic, I’m odd Erin, I’m Eire, esteemed islet. So hostile rifts ebb. Mob, I.R.A., dare not net R.U.C. – no cotton. Erase not, so I dare not nettle men in red rose garden – I’m in it.

Stop late men if foreign at nine. Esplanades, simple hotel, bath, gin – king is Edward IX; obese; Ma is no pure mater. Go! Rise, sir; part anon.

I also rehash tests – ‘O’ Level Latin, Italian. S.A.S., so, to track radar. Often nobleman exists alone – not sales reps – I do. Trade ceiling, i.e. final part, lures open if evil trade.

Volga River rises on no steppe. Elsinore has a hamlet – Oh, Bard, row on Avon!

A sacred robot nurses simple hero’s eye; dabs on it a lemon. Gas, iron, Essex often stops, suffers in a mania. Ron fixes several crofts, acer of maple. Hot, I fish; cold, I arise laden; if diary amiss, I know it set no car off. Foe-damned ruby motor, it only rebels.

Ian I swept aside to visit, in a bar of moorside red, Romanis met in a more mossy ale den. Inspired am I, Oswald. A bay bed is nine p on top. No name, niftiness- elder saw it. Oh no! Saw top wet star’s pool – part star, part otter. Refer a baron to idiot, Tony, as I did.

Smart ones use submarine.

Poet, arch-super-artiste, grew artistic. I lost rattle; my amiable, not oh so old, able to hang up, mina, can deliver it, so true. “Ta, matey!” – says so Boston (Mass.) elder I hit.

On file S.A.E. was sent – I wrote poster re fat on side, volume one – loved it, never off it, I was in. Aide mocks a manic; I mock comic, I nap: too bad I had a fit, I too. Bottle ban odd, I go drop mine, ergo trial ceded a fatness, sober if not so, or a test is debased.

A vet is agog – no pet’s in a cask – corgi dog, royal pet, a risk no more.

Lob a rod at a man I meet. Sewer delays pit fires – a bedlam in a dig – iron ore rots it. No devil is a hero – Nimrod.

At a mall a cod is all I get. I bet on Eva, so Tim ate whole eel bait, I pay tip, Eva had a hood sewed. No B.A. gave car to Nero, we were not to rev it and we lost a trail; I’m a free pill, I wrong a man. I erase gap; to help miss it, I fill a set. A gent in ire knocks a cadet.

Animals’ gel on spoon – it is so true to basics – I’d gel; too bad I hide kangaroo baths – I lived as I won raffle, flew as I did go, dash, to my, also too tired now, star comedy: A wan, inept, upset I’m retired, nut; its ilk, nicer. Nettle feels a sore; sad, I did no panic in a pain, am an ill or tired, nude, based item; it is a spot.

Semitone, not a tone, radios emit; no, on tape; elsewhere it’s a tone.

Tail is not on; pots open on foot, even on it, so let oven (on, it is) simmer – a hotpot’s a stupid ham stew.

Loop a loop, animal – cat up in air.

Both sacks I rate by apple hewn in elder’s garden if it rates, I was aware – tasted a core.

Zones or areas, Annie, cap, so twelfth girl, lass, alas, simply (alpha beta) done, Kate. Tadpole won top Oscar, Obadiah, “O” Level axed.

Argon gas did emit no straw, so ozone sure drops argon, oozes up in Ruth’s ample hotel or sits afar off in a bar – of elastic, is it?

I hate cinema; cinema dogs in a mass. Older effusion to old – lost, is it now? Reward: a mood.

All upsets it.

Radar trails an Islamic educer of a riling issue, damages it in Israel. Ceiling is, I say, a plan, a case of one deck. Can knees sag as one Latin image elates, I wonder?

Oboe diverts ultra foe, volatile bald ogre – push to berate; I’d do, ogre. So, p.m., Oct. first, never play organ’s stops – lay or put it up in ward ten.

Final cast like rowing – I sedate play, old as am I, God! Am I! On tacks I ran; I saw rats. A Gemini tramp is May born.

I back colony’s sober omen of lack of lace. Rome, not Paris, a wonder.

Obey retail law – a noose killed oyster. Reflate my ball, a water-filled one. Disabuse no name of emanating issue.

Damsels, I note, vary tastes so cost now desserts. I say no! Try taste more honeyed. A bad nemesis at naff ruse will upset. I, mere Satanist, e.g. rater of a devil – (Oh wrong is a sin!) – I’m no devil’s god, damned.

Animals, if on a mat, sit. Rain, a more vile drop, made us site it in a cottage. Breed deer – bottle fits a llama.

I lay, as I emanate, go to sleep, mad ones on docks – air is hot. Entrap, net, nine men in party raid – all if it is in a crab-pot room, an itemised, under-lit, nullified old log den – I’m sure voles made it rot in knot.

Tubas we see far off lack limit. A cat on still or tall upward paws to no dog is an ample hot-dog, ergo nastier if tastier, eh? We, raw amid a conman, a mama in a mask, corpse et al., err.

Octuple tracks at a son’s eyelash side distressed a tall eye doctor, a tall ace, rigger of a vote: got put in egress; odd, abased, is ebbed, as I am, Amy, asinine lot! Nine lots! Don’t six rams live? Don’t six exist?

Alfred, nuts or fool gigolo, trod never if gold locks all in a flap on a red rose; made nine or ten stops.

I heed never, I’m Daisy, a prod never, I terrorise viler starfish. To me suitors, no lemons, came rowing. Is a sin a mania? Rot!

Sit! I fix a looted amp or delay more, hasten not. A baser if snug stool, wonkier, if not – Alf says – super, a ballet to no devil, is a stool too. Ban it, actor, race to no tune.

May names I wrote wrong (Is no man in it, a long old log?) sit in row, sign irate Goths; I dare drop it. At felon’s eye I peer, fast open – I’m nosey, esteem eyes. All upset, ample hogs resume totting. Is sad nabob tired? Roots don’t evade liver in Alf’s gob.

Deers I held right; oblong, apt enamel or tile rifle on gun spot to get a man – aim is all. I rogate, minister. Feeble gnats, alas late, prosaic, a canine pet is not to consume hot.

Loo, wet, issues old idiot; evading, I sneer, obey a deer, gall a deer, gain alpine dragnet for egg I’d net to ram in a pan I made to help master. Rags I held, arcane poet, arcane poetic error, all odd; I bottle fine panacean lust. I’d nag elks I ride if editor toted a minor. I fog a natural life.

Roses, or level dumb ones – rows in a mown, ample, hewn acre. Wolfsbane made it a garden in May, a garden indeed.

Nine mates, nine tons I must save now on time – editor raps a late man. G.I.s edit also, too. Do over if tests in a task radiate. Rob ran; I, too, fled.

“Omega” – list in alphabet.

A gander, a line of live ducks, irk cubs. A wart, set at a cast on knee, snug as spots.

A poor denim for a janitor, racer, armed aide, solid idler – rabid; I’d elastic in a pot, tons to sew.

Tubes or axes went in a clam, in an oyster. Free booze – lap it all up. Pity, my apple hot, so I’d a root stew. God, a stew! Tip it at feline! Posies, a cat’s altar often, no baron packs. A monk caps dog – I meddle here – hot? Pull its leg! A bee was a hoot, eh?

No, it is opposite. Yaks I rode wore hats, albeit on deity’s orders. Rats age more held in a trap, nip and I know it – set no cage now.

It’s eta; no, it’s a beta – Tsar of Tonga rates isles. Mad Ed is all upset at cider, is Ed? Is a madam too? Snip? I’d snip, spot a fine position, snip nine more cinemas.

Do ogres sell in a mall? Yes, on a barge so rats row tubs.

Wall last canes up or Eros, an imp, lives to irk, rasp or dam all tides sent. I won’t – I was no Roman – even I saw tired row – a sore. He lives on. “No!” we yell.

Up, now! Wards are in nurses’ sole care. I, peer, fed, am too fat? Oh, not I, test no dined ruby ale; dote not on salad it’s in – I am sad.

Locks I rifle so troops atone re war. Only rebel or a crofter animates so cottage beheld arcades, so trees are sold, abased. I redo, rehang, I err – a wasted act; nests I’d – as an owl – laid. A boot’s raw foot, even if a foot to master, germs (ah!) can evil do.

Pan is tune-pipe – so hot notes, paths up to honeydew.

Odd locks, a maddened (I was aware) macaw on top, spot no seen knots, rifts or fan, I saw. Are maces a baton, madam? Oodles, madam? Rare laptops are too late – got too lit up.

Nits rub – snip now, I’ll abate, not snip, nits I held.

Nubile Danish tomboys I led to old loser as no melons I held; no fish to my name. Nod lower, do I dare? No, one nods a hairy snipe. (Edit: one hairy snipe, eh?) See silliness, else we’ll ask cornish to obey deity’s or god’s item. I, God, damn it! I was in it! To Hades, acne trap, sad loser! As warts pop, a dosser I – we – vile rat, sack! Same row, oh woe! Macaroni, rats, as a hoot, tie. I vomit on rats.";
return '$system> KERNEL ERROR (DOES. NOT. EXCIST)'
}

:)

Ruby - Die (optimierte und monkeymisierte!) Brute Force

Ich finde, der beste Weg, dies zu tun, ist der bekannte Monkey-Algorithmus, den Sie wahrscheinlich in BOOST finden können. Sie hatten immer Möglichkeiten, Sie zum Reden zu bringen ...

def palindrome?(in)#IMPORTANT
  if in.reverse == in
    return true
  else
    return false
end

def getMonkeys(in)#don't forget to interface with C in case of
  MaxMonkeys = 0
  MonkeyTalk = ""
  MonkeySpeed = in.length
  (0..MonkeySpeed).each do |monkeyA|
    (monkeyA..MonkeySpeed).each do |monkeyB|#optimized!
      if palindrome?(in[monkeyA..monkeyB]) do
        if in[monkeyA..monkeyB].length > MaxMonkeys do
          MonkeyTalk = in[monkeyA..monkeyB]
        end
      end
    end
  end
  MonkeyTalk
end

Dies ist äußerst ineffizient, aber ziemlich niedlich und rubinrot, wenn Sie alles in den ursprünglichen Namen umbenennen: MaxMonkeys = len; MonkeyTalk = result, MonkeySpeed ​​= strlen; monkeyA: a; Affe B: b; getMonkeys: getMaxPalindrome.
Dies hat für das OP keinen Wert und birgt die Gefahr, dass er sich entscheidet, tatsächlich mit C zu kommunizieren, und wir alle wissen, wie das endet ...

Python 2.7

Ich lehne es ab, die Standardfunktionen zu verwenden, da sie ineffizient sind. Jeder weiß, dass der beste Weg, eine Länge nachzuschlagen, darin besteht, eine Tabelle als Referenz zu haben. Daher erstelle ich eine Tabelle mit allen möglichen Palindromen und sortiere sie mit einem pythonischen Bogosort. Um die Effizienz zu verbessern, entferne ich zuerst Duplikate . Zu diesem Zeitpunkt berechne ich alle Elemente, die Palindrome sind, und sortiere sie nach Längen. Sie können dann einfach die letzte Länge in der Liste nehmen, die eine O (n) -Nachschlag enthält, indem Sie die Liste iterieren.

Code:

from itertools import chain, combinations
from random import *
stringToTest = "abba"

#Don't forget to reference code taken from stackoverflow. (http://stackoverflow.com/questions/464864/python-code-to-pick-out-all-possible-combinations-from-a-list)
def FindAllSubsetsOfAString(StringToFindASubsetOf):
  return chain(*map(lambda x: combinations(StringToFindASubsetOf, x), range(0, len(StringToFindASubsetOf)+1)))

listOfPermutations = []

#get the length of the string we are testing, as the python function is not portable across platforms
lengthOfStringToCheck = 0
for currentCharacterInString in stringToTest:
    lengthOfStringToCheck = lengthOfStringToCheck + 1
lengthOfStringToCheckMinusOne = lengthOfStringToCheck - 1
#Always iterate backwards, it is more efficient for  cache hits and misses
for stringBeginningIndex in range(lengthOfStringToCheck, 0, -1):
    listOfPermutations.append(stringToTest[stringBeginningIndex:lengthOfStringToCheckMinusOne])

#To save from errors, we must not operate directly on the list we have, that would be inefficient. We must copy the original list manually.
# The built in functions again aren't portable, so we must do this manually, with a deep copy.
OtherListOfPermutations = []
for CurrentItemInOriginalList in listOfPermutations:
    TemporaryListItem = []
    for CurrentIndexInCurrentItemInOriginalList in CurrentItemInOriginalList:
        TemporaryListItem.append(CurrentIndexInCurrentItemInOriginalList)
    OtherListOfPermutations.append(''.join(TemporaryListItem))

#Get all of the possible strings into the OtherListOfPermutations List.
# Use Generators, and itertools. It's more efficient and more pythonic
for OriginalString in listOfPermutations:
    for CurrentPermutationInCurrentString in FindAllSubsetsOfAString(OriginalString):
      OtherListOfPermutations.append(''.join(list(CurrentPermutationInCurrentString)))

#Sort the list
ListOfStringsSortedByLength = OtherListOfPermutations
while not all(len(ListOfStringsSortedByLength[i]) <= len(ListOfStringsSortedByLength[i+1]) for i in xrange(len(ListOfStringsSortedByLength)-1)):
    shuffle(ListOfStringsSortedByLength)

#Remove all of the duplicates in the sorted list
ListOfStringsSortedByLengthWithoutDuplicates = []
for CurrentStringWorkingWith in OtherListOfPermutations:
    HaveFoundStringInList = False
    for CurrentTemporaryString in OtherListOfPermutations:
        if CurrentStringWorkingWith == CurrentTemporaryString:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfStringsSortedByLengthWithoutDuplicates.append(CurrentStringWorkingWith)

#Use the ListOfStringsSortedByLengthWithoutDuplicates and check if any of the strings are palindromes
ListOfPotentialPalindromes = []
for TemporaryStringToUseForPalindromes in ListOfStringsSortedByLengthWithoutDuplicates:
    lengthOfStringToCheck = 0
    for currentCharacterInString in TemporaryStringToUseForPalindromes:
        lengthOfStringToCheck = lengthOfStringToCheck + 1
    if lengthOfStringToCheck != 0:
        TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
        if TemporaryStringToUseForPalindromesReversed == TemporaryStringToUseForPalindromes:
            ListOfPotentialPalindromes.append(TemporaryStringToUseForPalindromes)

#Remove any duplicates that might have snuck in there
ListOfPotentialPalindromesWithoutDuplicates = []
for CurrentPotentialPalindrome in ListOfPotentialPalindromes:
    HaveFoundStringInList = False
    for CurrentTemporaryPalindrome in ListOfPotentialPalindromes:
        if CurrentPotentialPalindrome == CurrentTemporaryPalindrome:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfPotentialPalindromesWithoutDuplicates.append(CurrentStringWorkingWith)

lengthOfPalindromes = []

for CurrentPossiblePalindrome in ListOfPotentialPalindromesWithoutDuplicates:
    CurrentPossiblePalindromeLength = 0
    for currentCharacterInPossiblePalindrome in CurrentPossiblePalindrome:
        CurrentPossiblePalindromeLength = CurrentPossiblePalindromeLength + 1
    lengthOfPalindromes.append(CurrentPossiblePalindromeLength)


while not all(lengthOfPalindromes[i] <= lengthOfPalindromes[i+1] for i in xrange(len(lengthOfPalindromes)-1)):
    shuffle(lengthOfPalindromes)

#find the last value in the list:
currentValue = 0
for currentPalindromeLength in lengthOfPalindromes:
    currentValue = currentPalindromeLength

print currentValue

Hinweis

Nicht wirklich geeignet für Zeichenfolgen, die länger als 4 Zeichen sind. Ist "abba" in Ordnung, aber ich ging Kaffee kaufen und kochte das Mittagessen, bevor es abcba tat

Probleme:

Wahnsinnige Variablennamen (und auch inkonsistent)
Lächerliche Algorithmusauswahl (Berechne alle möglichen Permutationen für jeden Teilstring der angegebenen Zeichenfolge, überprüfe, ob es sich um Palindrome handelt, sortiere sie nach Länge und suche den letzten Wert)
Enthält tatsächlich die Lösung des Problems

    TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1] 

Blöder Sortieralgorithmus (Bogosort) und eine Nutjob-Methode, um sicherzustellen, dass die Liste sortiert ist.

Außerdem gibt es einen Einrückungsfehler bei der Duplikatprüfung, der eigentlich gar nichts bewirkt. Es ist nur Zeitverschwendung.

C

Das Auffinden von Palindromen ist eine schwierige PNP * -Operation, daher muss sie mit hochoptimiertem Code durchgeführt werden. Hier sind fünf Optimierungstricks, mit denen Sie die Lösung schneller finden.

1. Beginnen Sie mit der richtigen Sprache. Wie jeder weiß, ist "C" am schnellsten.
2. Verwenden Sie einen schnellen Algorithmus. BoyerMoore ist der Weltrekordhalter für die Suche nach Saiten, also werden wir das nutzen. Wir werden auch zuerst nach den längsten Teilzeichenfolgen suchen, damit wir die beste Chance haben, eine lange Übereinstimmung zu finden.
3. Kennen Sie Ihren Prozessor. Moderne Computer sind in Zweigen der if this else thatForm schrecklich langsam . (Im weiteren Verlauf Ihrer Karriere sollten Sie die ifVerzweigungsvorhersage beherrschen, wenn Sie ein echter Code-Ninja sein möchten.) Mit diesem Code wird das Verzweigungsproblem vermiedenfor Anweisungen verwenden, die Ihnen 3 Anweisungen zum Preis von einer geben.
4. Achten Sie auf die "Big-O". Dieser Algorithmus verwendet keine geschweiften Klammern in den Funktionskörpern, wodurch verschachtelte Schleifen vermieden werden. Die Laufzeit muss also O (N) sein.
5. Vergessen Sie nicht die Mikrooptimierungen. Durch die bekannte Methode, alle Leerzeichen zwischen Anweisungen zu entfernen, konnte ich die Arbeitslast des Compilers reduzieren und eine weitere Beschleunigung von 10% erzielen.

Aber nicht an Variablennamen sparen, Lesbarkeit ist wichtig.

^{* Palindrom-Nicht Palindrom}

#define OFFSET 0XFF
#define ln(s) strlen(s) //macro to avoid runtime overhead

char* boyermore(char* needle, char* haystack){
  int i,k[OFFSET];
  for(i=0;i<OFFSET;i++)k[i]=ln(haystack);
  for(i=1;i<ln(haystack);i++)k[haystack[i]]=ln(haystack)-i;
  for(i=2;ln(needle)>=ln(haystack);needle+=k[needle[ln(haystack)]])
  for(i=ln(haystack)-1;needle[i]==haystack[i];i--)if(!i)return needle;
  return 0xFF-OFFSET;
}

char* reverse(char*src,char*dest,int loops){
  for(*(src+loops)=0;loops;src[--loops]=*(dest++));
  return src;
}

#define imax(a,b) ((a>b)?a:(b))
int main(int i, char*in[2]){
  char* is,*begin,*maybe,max=-1;
  char* end=in[-max],*start=end+ln(end);
  for(begin=malloc(start-end);--start>end;)
  for(i=start-end;i>0;i--)
  for(maybe=reverse(begin,start-i,i);boyermore(in[1],maybe);*maybe=1)
  for(;i>max;max=imax(i,max))is=start-i;
  for(maybe="found";max>0;max=-max) puts(reverse(begin,is,max));
}  

_{Neben dem offensichtlichen Trolling im Kommentar gibt es noch einige andere Probleme. Der Suchalgorithmus ist eine gültige Implementierung von Boyer-Moore-Horspool, speichert jedoch niemals die Stringlängen, sondern ruft stattdessen so etwas wie N * M-mal auf, was ihn viel langsamer als eine einfache Suche macht. "Zuerst nach der längsten Zeichenfolge suchen" ist wahr, danach wird jedoch nicht nach der Längenreihenfolge gesucht, sodass ein vorzeitiges Beenden eine falsche Antwort ergibt, wenn es implementiert wurde. Ist es aber nicht, so sucht es das ganze N! Möglichkeiten sowieso. Und fast alle Parameternamen (Nadel / Heuhaufen; src / dest) sind von ihrer Standardbedeutung umgekehrt.}

Folgendes habe ich bisher in VB6:

Public Function strLongestPalindrome(ByVal strInput as String) as String

    strLongestPalindrome = ""
    Dim a as Integer
    Dim b as Integer

    For a = 1 To Len(strInput)
        For b = 1 to a
            Dim c as Integer
            Dim d as Integer
            c = a
            d = b
            Do
                If Mid$(strInput, c, 1) = Mid$(strInput, d, 1) Then
                    c = c + 1
                    d = d - 1
                    If c >= d Then
                        strPalindrome = Mid$(strInput, a, b-a+1)
                        If Len(strLongestPalindrome) < Len(strPalindrome) Then
                            strLongestPalindrome = strPalindrome
                        End If
                        Exit Do
                    End If
                Else
                    Exit Do
                End If
            Loop
        Next
    Next

End Function

Aber ich denke nicht, dass es funktioniert, und ich denke, ich kann es besser machen.

Hier ist eine Java-Lösung für Sie:

public String findLongestPalindrome(String s){
   if(s.equals("the longest palindrome")){
      return "the longest palindrome";
   }else{
      throw new IllegalArgumentException();
   }
}

AutoHotkey

;msgbox % longest_palindrome_in_string("racecar abcdedcba alkdf")

longest_palindrome_in_string(str){
l := Strlen(str) , max := 1
loop % l
{
    p := A_index
    loop % l-p
    {
        s := Substr(str, p, A_index+1) , k := ""
        loop, parse, s
            k := A_LoopField k
        if k = %s%
            if (sl:=Strlen(s)) > max
                out := s , max := sl
    }
}
return out
}

Die Funktion gibt auch Leerzeichen zurück, da sie Teil einer Palindromsequenz in einer Zeichenfolge sind. Das oben Gesagte kehrt also zurück <space>abcdedcba<space>.

Polyglot

Dies ist Trolling, weil es darum bittet, "das längste Palindrom in einer Zeichenfolge zu finden", also das längste Palindrom in "einer Zeichenfolge" zu finden.

String palindrome(){
    return null; //There are no palindromes in "a string"
}

Ich hätte nie gedacht, dass Saiten Palindrome enthalten könnten. Können Sie mir zeigen, wo Sie das gelernt haben? Wenn Sie das längste Palindrom benötigen, besuchen Sie bitte diese Website: http://www.norvig.com/pal2txt.html

Durchlaufen Sie jedes Zeichen der Zeichenfolge. Überprüfen Sie dann die Zeichen vor und nach diesem Zeichen. Dann die Zeichen zwei vor und zwei nach diesem Zeichen. Wiederholen Sie dies, bis Sie zu Zeichen kommen, die nicht gleich sind. Auf diese Weise können Sie die Länge jedes Palindroms im Wort identifizieren. Diese Methode funktioniert jedoch nur für Palindrome ungerader Länge. Um nach Palindromen gleicher Länge zu suchen, überprüfen Sie die Zeichen an Position i und i-1, dann i + 1 und i-2, dann i + 2 und i-3 usw. Ich hoffe, dies hilft !!

Die naheliegende Antwort besteht darin, die Zeichenfolge mit ihrer eigenen Inversen zu vergleichen und die längste gemeinsame Sequenz zu berechnen.

Das folgende Perl-Programm macht genau das. Möglicherweise müssen Sie das Acme :: DonMartin-Modul herunterladen. Es wird normalerweise nicht standardmäßig installiert.

use Acme::DonMartin;

sklush klikrunk skroik hee doodle shompah sproingdoink varoom hushle
fwiskitty twop pok zich frack gleep shloop zgluk zlitz faroolana deebe
fump kachoo zock fween boong pitooie oggock gahoff glip fwask padap fut
ooga chukkunk shkaloink kazash splosh sklizzorch fak ahh doom twop
beedoop gak wee fitzrower shkwitz shklik fweep spla gring glink splurp
thomp fwoof thoom kipf ging krunch blib ga kikatik bash dap thork huff
katoonk fak shik stoof dimpah skapasch skronch kachunka arargh sprat
gonk yip inkle blink fagwoosh fowm splapple blamp doomp ploom gishklork
shwik fomp plortch skroik gashplutzga plortch da goyng shtork borfft
zwot ping puffa trump thlip dig blonk thhhut splatch doonk sklizzorch
sprazot pwof slapth spashle kreek eck kik dit foing glukkle glikity
spazoosh plapf gashklitz mabbit boong sklortch swipadda sknikle phelop
skloshitty zat dokka splazitch tika zikka fling shooka glangadang
brrrapp fwizz gasploosh doop swish dikka splesh shooka blut galink
yeech caw tink sklitch shash tffp skrink poffisss oont spazoosh blort
aarh ting ho shpikkle shompah tood shkalink gloople skloshitty

Lua / Python

Lua ist eine sehr schnelle Sprache (die Sie brauchen, weil es viele zu überprüfende Teilzeichenfolgen gibt!), Aber Python ist besser im Umgang mit Zeichenfolgen. Warum also nicht beide verwenden?

Weil ich gehört habe, dass es gut ist, lokale Variablen zu haben, habe ich eine. Außerdem habe ich die Funktionsaufrufe von ihren Argumenten getrennt, da zu viele Argumente Ausdrücke unübersichtlich und unleserlich machen.

Ich denke auch, dass dies mit allen Zeichenfolgen funktioniert, die Sie ausprobieren möchten. Es wird wahrscheinlich keine Probleme mit seltsamen Eingaben geben.

function is_palindrome()
    if os.execute("python -c 'exit(\"" .. is_palindrome_argument .. "\"==\"" .. is_palindrome_argument .. "\"[::-1])'") == true then
        return false
    else
        return true
    end
end

function longest_palindrome()
    local longest -- very important to use local variables
    for length = 1, #longest_palindrome_argument do
        for start_index = 1, #longest_palindrome_argument - length + 1 do
            is_palindrome_argument = string.sub(longest_palindrome_argument, start_index, start_index + length - 1)
            if is_palindrome() then
                longest = is_palindrome_argument
            end
        end
    end
    return longest
end

longest_palindrome_argument = "foo racecar"
print(longest_palindrome())

(Übrigens, Sie werden nicht glauben, wie lange ich dafür gebraucht habe.)

Python Einzeiler:

s = "here goes your string"
print max(p for p in [s.lower()[j:i] for i in range(len(s) + 1) for j in range(len(s) + 1) if ' ' not in s[j:i] and s[j:i] != '' and len(s[j:i]) > 2] if p == p[::-1])

Python - 126 Zeichen

Hier ist mein Ansatz:

k=[]
for i in range(len(p)):
 for j in range(i,len(p)):
  if p[i:j]==p[j:i:-1]:
   k.append(p[i:j+1])
k.sort(key=len)
k=k[-1]

Dies funktioniert, glaube ich, sowohl in Python 2.x als auch in Python 3.x. Die Variable k enthält die Antwort.

EDIT: Ich habe vergessen zu sagen, die Variable p sollte die Zeichenkette enthalten, um nach Palindromen zu suchen.

Dies ist eine legitime Implementierung, daher funktioniert sie für jede Zeichenfolge.

Java

Wenn aStringes sich um ein Palindrom handelt, aStringist es offensichtlich das längste Palindrom im Inneren aString. An der Aussage kann man erkennen, dass es funktioniert. Denken Sie nicht zu viel über die erste Zeile des ausführbaren Codes nach. Das ist nur Standard Java Boilerplate.

public CharSequence findLongestPalindromeInside(String aString)
{
       aString=new StringBuilder(aString).append(new StringBuilder(aString).reverse());
       assert isPalindrome(aString);
       return aString;
}

public boolean isPalindrome(CharSequence charSequence)
{
      return charSequence.toString().equals(new StringBuilder(charSequence).reverse().toString());
}

Game Maker-Sprache

var str,length,i,out,char;
str=argument0
out=""
length=string_length(argument0)
for(i=0;i<string_length(argument0);i+=1){
 char=string_char_at(str,length-i)
 out+=char
}
return argument0+out;

Fortran

Saiten sind in Fortran zu schwierig, deshalb habe ich mich für die Verwendung entschieden iachar , sie alle in Ganzzahlen umzuwandeln:

program long_palindrome
   implicit none
   character(len=100) :: string
   integer, dimension(100) :: fwd,rev
   integer :: i,j,fs,fe,rs,re

   print *,"enter string with palindrome hidden in it (max 100 characters)"
   read(*,*) string
   fwd = 0

! convert characters to ASCII integers
   do i=1,len(trim(string))
      fwd(i) = iachar(string(i:i))
   enddo

! reverse whole array
   j=len(trim(string))
   do i=1,len(trim(string))
      rev(i) = fwd(j)
      j = j-1
   enddo

! match strings of fwd and rev
   rs = 1; re = len(trim(string))
   fs = 1; fe = len(trim(string))

! test to see if whole thing is a palindrome
   if(all(fwd(fs:fe)==rev(rs:re))) then
      print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
      stop
   endif

! nope? oh well, guess we have to loop through and find it
   fs = 0
   do
      fs = fs+ 1
      do fe = len(trim(string)),fs+1,-1
         do rs=1,fs
            re = fe-rs+1
            if(all(fwd(fs:fe)==rev(rs:re))) then
               print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
               stop
            endif
         enddo
      enddo
      if(fs==len(trim(string))-1) exit
   enddo

   print *,"hmm, doesn't look like there was a palindrome of length > 1..."
end program long_palindrome

Es funktioniert nicht genau. Angenommen, die Zeichenfolge aabbaacsagt, dass die längste ist aa, aber angenommen, die Zeichenfolge acasdabbbaabbsagt, dass die längste ist abbba. Nahe genug.

Sie können auf dem heutigen Markt nicht mit dem konkurrieren, was gefragt ist. Dieser Code findet auch das kürzeste Palindrom und unterscheidet nicht zwischen Groß- und Kleinschreibung:

def flp(s):
    lp = 'the longest palindrome'
    sp = 'the shortest palindrome'
    return lp if lp in s.lower() else sp if sp in s.lower() else ''

>>> flp('xxxxthe longest palindromexxxx')
'the longest palindrome'
>>> flp('xxxxthe shortest palindromexxxx')
'the shortest palindrome'

Lua

function findPalendromes(str)
    str=str.." "
    ret_s=""
    for s in str:gmatch"(%w+)[ ]" do
        if s==s:reverse() and s:len()>ret_s:len() then ret_s=s end
    end
    return ret_s
end

Effizienteste Python-Implementierung, die alle anderen Bemühungen übertrifft:

def find_the_longest_palindrome(s):
    print "'the longest palindrome' found at : " + str(s.find("the longest palindrome"))

Anmerkungen:

Dies wird immer "das längste Palindrom" finden

Es wird zwischen Groß- und Kleinschreibung unterschieden.

Mit einigen Modifikationen können auch andere Zeichenfolgen gesucht werden. Sie müssen jedoch eine Klasse erstellen, eine geeignete Methode hinzufügen und diese dann für jede zu findende Zeichenfolge in Unterklassen unterteilen.

Diese Funktion könnte durch Portierung auf FORTRAN 77 oder Festcodierung in Intel 8008-Maschinencode verbessert werden.

Dies ist meine erste Antwort auf Code-Trolling. Es ist kein besonders brutaler Troll, es kam mir nur albern vor, die Frage zu beantworten

private static String findLongestPalindrome(String input) {
    String longest = null;
    for (int i = 1; i <= input.length(); i++) {
        Matcher m = pattern(i).matcher(input);
        if (m.find()) {
            longest = m.group();
        }
    }
    return longest;
}

private static Pattern pattern(int len) {
    int size = len / 2;
    StringBuilder sb = new StringBuilder();
    for (int i = 0; i < size; i++) {
        sb.append("(.)");
    }

    if (len != size * 2) {
        sb.append(".");
    }

    for (int i = size; i > 0; i--) {
        sb.append("\\").append(i);
    }
    return Pattern.compile(sb.toString());
}

Trolle sind:

• Manuelles Erstellen jedes Mal desselben Musters
• Verwenden teurer Rückreferenzen, um Palindrome zu finden
• Iterieren Sie von 1 zu input.length () (in umgekehrter Reihenfolge wird garantiert, dass die erste Übereinstimmung, die Sie finden, die längste ist. Die obige Vorgehensweise ist dumm).

Python 3

from itertools import takewhile

def common_part(s1, s2):
    return sum(takewhile(bool, (a==b for a, b in zip(s1, s2)))) 

def palindromes(s):
    for i in range(1, 2*len(s)):
        m = i//2; n = i - m
        common = common_part(s[n-1::-1], s[m:])
        p = s[n-common:m+common]
        if p: yield p

string = input('> ')

print('Longest palindrome is', repr(max(palindromes(string), key=len)))

Sehr effizientes Programm. Es sucht nach langen Palindromen mit dem Zentrum in aufeinanderfolgenden Positionen (auf dem Zeichen und dazwischen) und wählt das längste aus